Review



gene expression microarray experiment  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher gene expression microarray experiment
    Gene Expression Microarray Experiment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/pmc05782396-239-15-14
    Average 86 stars, based on 1 article reviews
    gene expression microarray experiment - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    other:


    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

    Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders
    Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× annexin-binding buffer (Thermo Fisher, Waltham, MA, USA, #V13245), then resuspended in 100μL of 1× annexin-binding buffer.

    Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay
    Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array.

    Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells.
    Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161.


    Microarray:

    Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver.
    Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed.

    Synthesized:

    Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver.
    Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed.

    Expressing:

    Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver.
    Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed.

    Real-time Polymerase Chain Reaction:

    Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver.
    Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed.

    Gene Expression:

    Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver.
    Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed.



    Similar Products

    90
    DNA Chip Research Inc gene expression microarray experiments
    Gene Expression Microarray Experiments, supplied by DNA Chip Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/gene+expression+microarray+experiments/pm38169039-67-112-121
    Average 90 stars, based on 1 article reviews
    gene expression microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Biotechnology Information gene expression microarray experiments
    Gene Expression Microarray Experiments, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/microarray+data/pm32992193-151-89-107
    Average 90 stars, based on 1 article reviews
    gene expression microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Biotechnology Information microarray gene expression experiments
    Microarray Gene Expression Experiments, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/microarray+data/pmc07503504-136-18-28
    Average 90 stars, based on 1 article reviews
    microarray gene expression experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Shanghai Biotechnology Co Ltd microrna microarray gene expression experiments
    ZEB1-AS1 sponges miR-141-3p in CRC cells. ( A ) Nuclear and cytoplasmic fractionation was analyzed for ZEB1-AS1 expression in SW480 and LOVO. ( B ) The <t>microRNA</t> array analysis in normal and tumor tissues. ( C ) The potential binding sites between ZEB1-AS1 and miR-141-3p. ( D ) The expressions of miR-141-3p in CRC tissues were detected by RT-qPCR. ( E ) Luciferase reporter assay showed ZEB1-AS1-wt activity was impaired by miR-141-3p. ( F ) The expression of miR-141-3p in SW480 and LOVO was upregulated after ZEB1-AS1 expression was downregulated identified by RT-qPCR. ( G ) The expression of miR-141-3p was negatively correlated with ZEB1-AS1 expression in CRC tissues. * P < 0.05.
    Microrna Microarray Gene Expression Experiments, supplied by Shanghai Biotechnology Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/human+mirna+microarray/pmc07359398-65-6-0
    Average 90 stars, based on 1 article reviews
    microrna microarray gene expression experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Welgene Biotech gene expression microarray experiments
    ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from <t>microarray</t> data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.
    Gene Expression Microarray Experiments, supplied by Welgene Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/microarray+analysis/pmc06856590-85-14-9
    Average 90 stars, based on 1 article reviews
    gene expression microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    86
    Thermo Fisher gene expression microarray experiment
    ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from <t>microarray</t> data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.
    Gene Expression Microarray Experiment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/pmc05782396-239-15-14
    Average 86 stars, based on 1 article reviews
    gene expression microarray experiment - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    90
    Illumina Inc microarray gene expression experiments illumina wg-dasl humanref-8 v3
    ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from <t>microarray</t> data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.
    Microarray Gene Expression Experiments Illumina Wg Dasl Humanref 8 V3, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/microarray+gene+expression+experiments+illumina+wg+dasl+humanref+8+v3/10__1164_slash_rccm__201602___0300oc-114-4-14
    Average 90 stars, based on 1 article reviews
    microarray gene expression experiments illumina wg-dasl humanref-8 v3 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Bioarray Inc gene expression microarray experiments
    ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from <t>microarray</t> data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.
    Gene Expression Microarray Experiments, supplied by Bioarray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/gene+expression+microarray+experiments/pmc05355296-261-0-7
    Average 90 stars, based on 1 article reviews
    gene expression microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Biopharm GmbH gene expression data from microarray experiments
    ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from <t>microarray</t> data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.
    Gene Expression Data From Microarray Experiments, supplied by Biopharm GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/microarray+gene+expression+experiments/gene+expression+data+from+microarray+experiments/pm23000192-394-24-27
    Average 90 stars, based on 1 article reviews
    gene expression data from microarray experiments - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    ZEB1-AS1 sponges miR-141-3p in CRC cells. ( A ) Nuclear and cytoplasmic fractionation was analyzed for ZEB1-AS1 expression in SW480 and LOVO. ( B ) The microRNA array analysis in normal and tumor tissues. ( C ) The potential binding sites between ZEB1-AS1 and miR-141-3p. ( D ) The expressions of miR-141-3p in CRC tissues were detected by RT-qPCR. ( E ) Luciferase reporter assay showed ZEB1-AS1-wt activity was impaired by miR-141-3p. ( F ) The expression of miR-141-3p in SW480 and LOVO was upregulated after ZEB1-AS1 expression was downregulated identified by RT-qPCR. ( G ) The expression of miR-141-3p was negatively correlated with ZEB1-AS1 expression in CRC tissues. * P < 0.05.

    Journal: International Journal of Medical Sciences

    Article Title: Long noncoding RNA ZEB1-AS1 acts as a Sponge of miR-141-3p to Inhibit Cell Proliferation in Colorectal Cancer

    doi: 10.7150/ijms.46698

    Figure Lengend Snippet: ZEB1-AS1 sponges miR-141-3p in CRC cells. ( A ) Nuclear and cytoplasmic fractionation was analyzed for ZEB1-AS1 expression in SW480 and LOVO. ( B ) The microRNA array analysis in normal and tumor tissues. ( C ) The potential binding sites between ZEB1-AS1 and miR-141-3p. ( D ) The expressions of miR-141-3p in CRC tissues were detected by RT-qPCR. ( E ) Luciferase reporter assay showed ZEB1-AS1-wt activity was impaired by miR-141-3p. ( F ) The expression of miR-141-3p in SW480 and LOVO was upregulated after ZEB1-AS1 expression was downregulated identified by RT-qPCR. ( G ) The expression of miR-141-3p was negatively correlated with ZEB1-AS1 expression in CRC tissues. * P < 0.05.

    Article Snippet: Shanghai Biotechnology Co., Ltd conducted the microRNA microarray gene expression experiments and data analysis.

    Techniques: Fractionation, Expressing, Binding Assay, Quantitative RT-PCR, Luciferase, Reporter Assay, Activity Assay

    ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from microarray data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.

    Journal: Journal of Cancer

    Article Title: Downregulated Salt-inducible Kinase 3 Expression Promotes Chemoresistance in Serous Ovarian Cancer via the ATP‐binding Cassette Protein ABCG2

    doi: 10.7150/jca.34886

    Figure Lengend Snippet: ABCG2 upregulation is associated with SIK3 attenuation. (A) List of ABC family proteins from microarray data for which the expression changed more than 1.5-fold compared with control cells. (B) The mRNA expression levels of ABC proteins were verified by real-time PCR in OVCAR4 and SKOV3 cells. The white bar (shLuc) represents control cells, and the gray bar (shSIK3#01) and black bar (shSIK3#61) represent indicated cells with SIK3 knockdown. Data are represented as the mean ± SEM from three independent experiments and analyzed by one-way ANOVA. *: p <0.05 and **: p <0.01 (compared to the shLuc control). Note that ABCG1 and ABCG2 were both significantly upregulated in cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (C) The protein expression levels of ABCG1 and ABCG2 were further verified by Western blotting. Note that only ABCG2 was upregulated in OVCAR4 and SKOV3 cells with SIK3 knocked down by shSIK3#01 and shSIK3#61. (D) The functional MDR activity of the ABCG2 protein was determined using an MDR assay kit (Abcam). A total of 2 x 10 5 suspended cells were pretreated with the inhibitor novobiocin (50 nM) or DMSO. Then, diluted Efflux Gold Detection Reagent was added at 37°C for 30 minutes. The cellular orange fluorescence signal of the Efflux Gold Detection Reagent was measured immediately by flow cytometry in the living (PI-negative) cell population. The numbers in the upper left corners are MAF values.

    Article Snippet: TRIzol-isolated RNA samples were shipped on dry ice to Welgene Biotech (Taiwan), where the gene expression microarray experiments were performed as a contract service.

    Techniques: Microarray, Expressing, Control, Real-time Polymerase Chain Reaction, Knockdown, Western Blot, Functional Assay, Activity Assay, Fluorescence, Flow Cytometry