gene expression microarray experiment (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
86
Structured Review
Thermo Fisher
gene expression microarray experiment
Gene Expression Microarray Experiment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/microarray+gene+expression+experiments/pmc05782396-239-15-14
Average 86 stars, based on 1 article reviews
Gene Expression Microarray Experiment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/microarray+gene+expression+experiments/pmc05782396-239-15-14
Average 86 stars, based on 1 article reviews
gene expression microarray experiment - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
other:Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders. Article Snippet: Article Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders Article Snippet: After 72h of culture, cells were washed twice with 200μL of 1× Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay Article Snippet: TaqMan assays SYBR Green assay , FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) , BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) , CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG , GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC. , TaqMan ® assay: DDB2 (Hs00172068_ml), FDXR (HS01031617_ml), ITFG1: Hs01061271_ml SYBR Green assay: CDKN1A F:CCT CAT CCC GTG TTC TCC TTT CDKN1A R: GTA CCA CCC AGC GGA CAA GT GAPDH F: CGA CCA CTT TGT CAA GCT CA GAPDH R: AGG GGT CTA CAT GGC AAC TG HPRT F: TGA CAC TGG CAA AAC AAT GCA HPRT R: GGT CCT TTT CAC CAG CAA GCT , FDXR (HS01031617_ml) , DDB2 (Hs00172068_ml), FDXR (HS01031617_ml) , RNA amount used for cDNA synthesis , 0.2 μg; 1.65 μg per array. Article Title: Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells. Article Snippet: Please cite this article as: Lipreri da Silva, J.C., Lima, K., Ede, B., Lazarini, M., Vicari, H.P., Nogueira, F.L., Clayton, N.S., Pinnell, K., Silva, W.F.d., Velloso, E.D.R.P., Bendit, I., Costa-Lotufo, L.V., Rego, E.M., Ridley, A.J., Machado-Neto, J.A., Pharmacological inhibition of ezrin reduces proliferative and invasive phenotype in acute lymphoblastic leukemia cells, European Journal of Pharmacology, https:// doi.org/10.1016/j.ejphar.2024.177161. Article Title: Multi-modal analysis reveals tumor and immune features distinguishing EBV-positive and EBV-negative post-transplant lymphoproliferative disorders Article Snippet: Microarray:Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver. Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed. Synthesized:Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver. Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed. Expressing:Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver. Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed. Real-time Polymerase Chain Reaction:Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver. Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed. Gene Expression:Article Title: Exposure to a choline-deficient diet during pregnancy and lactation alters the liver transcriptome profile in offspring of dams with fatty liver. Article Snippet: Background & aims: The developmental origin of health and disease hypothesis shows that early adverse exposures can have lifelong health effects.. Thus, the aim of this study was to analyze the impact of choline intake during pregnancy and/or lactation on gene expression profiles in the liver of 24-day-old male rat offspring from dams with non-alcoholic fatty liver disease (NAFLD).. Methods: Phenotypic characteristic, histological examination and global transcriptome pattern of liver tissue specimens obtained from offspring of dams suffering from fatty liver, provided with proper choline intake during pregnancy and lactation (NN), fed a choline-deficient diet during both periods (DD), deprived of choline only during pregnancy (DN), or only during lactation (ND), was performed. |
